Which one is the correct product of DNA dependent RNA polymerase to the given template?
3' TACATGGCAAATATCCATTCA5'
Text Solution
Verified by ExpertsC
The process of copying genetic information from one strand of the DNA into RNA is termed as transcription. The process of transcription is catalyzed by the enzyme DNA dependent RNA polymerase in only one direction, that is, 
, the strand of DNA that has the polarity 
' acts as a template, and is also referred to as template strand. The given template strand of DNA is:
3'-TACATGGCAAATATCCATTCA 5'
So, the transcribed strand of RNA will be:
5'AUGUACCGUUUAUAGGUAAGU 3'
Prepare Smarter with CGP Edu
Get practice questions, solutions, and test series in one place.
Write a Review
Share your experience with this question and solution.
Commentary
Send your comment, doubt, correction, or feedback to admin.
Similar Questions
Explore conceptually related problems