Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follow
5'AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3?
Text Solution
Verified by ExpertsC
The two strands have opposite polarity and the DNA-dependent RNA polymerase also catalysed the polymerisation in only one direction, i.e., 
, The strand that has the polarity 
acts a template, and is also referred to as template strand. The other stand which has polarity 
and the sequence same as RNA (except thymine at the place of uracil), is displaced during transcription. This strand is referred to as coding strand.
Prepare Smarter with CGP Edu
Get practice questions, solutions, and test series in one place.
Write a Review
Share your experience with this question and solution.
Commentary
Send your comment, doubt, correction, or feedback to admin.
Similar Questions
Explore conceptually related problems